T4 RNA Ligase 2, truncated K227Q from New England Biolabs

Product Specs
ItemT4 RNA Ligase 2, truncated K227Q
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0351L
Quantity10000 units
ApplicationsFunctional Genomics
Brand/TrademarkNew England Biolabs Inc (NEB)
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Transcriptome-wide analysis of the function of Ded1 in translation preinitiation complex assembly in a reconstituted in vitro systembioRxivOctober 20, 2023Fujun Zhou, Julie M. Bocetti, Meizhen Hou, Daoming Qin, Alan G. Hinnebusch, Jon R. Lorschcontaining 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled

(2) Mechanisms of readthrough mitigation reveal principles of GCN1-mediated translational quality controlCellJuly 20, 2023Martin B.D. Müller, Prasad Kasturi, Gopal G. Jayaraj, F. Ulrich Hartldephosphorylated with T4 PNK (NEB, M0201S) and ligated to a DNA barcoded linker using T4 Rnl2(tr) K227Q (NEB, M0351L). Non-ligated linkers were removed using yeast 5′-deadenylase and RecJ. rRNA depletion was performed

(3) Promiscuous splicing-derived hairpins are dominant substrates of tailing-mediated defense of miRNA biogenesis in mammalsCell ReportsFebruary 16, 2023Seungjae Lee, David Jee, Sid Srivastava, Acong Yang, Abhinav Ramidi, Renfu Shang, Diane Bortolamiol-Becet, Sébastien Pfeffer, Shuo Gu, Jiayu Wen, et al.,Life Technologies,Cat#15596-018 GeneScreen Plus membrane,PerkinElmer,Cat#NEF1017001PK T4 RNA ligase 2 (1-249; K227Q),NEB,Cat#M0351L T4 RNA ligase 1,NEB,Cat#M0204L Superscript III RT kit,Invitrogen,Cat#18080-051 Dynabeads Protein

(4) Profiling lariat intermediates reveals genetic determinants of early and late co-transcriptional splicingMolecular CellDecember 1, 2022Yi Zeng, Benjamin J. Fair, Huilin Zeng, Aiswarya Krishnamohan, Yichen Hou, Johnathon M. Hall, Alexander J. Ruthenburg, Yang I. Li, Jonathan P. Staley,Thermo Fisher Scientific,AM2238 RppH,NEB,M0356S Terminator™ 5´-Phosphate-Dependent Exonuclease,Lucigen,TER51020 T4 RNA Ligase 2 truncated K227Q,NEB,M0351L Superscript III,Thermo Fisher Scientific,18080044 ExoSAP-IT,Thermo Fisher Scientific,78250.40.UL Circligase,Lucigen,CL4115K Phusion

(5) GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasiseLifeSeptember 15, 2022Cordova RA, Misra J, Amin PH, Klunk AJ, Damayanti NP, Carlson KR, Elmendorf AJ, Kim HG, Mirek ET, Elzey BD, et al.5′-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. #M0351L). The resulting tRNAs were then ligated to a 5′-adaptor, annealed to an RT primer, and converted to

(6) MiRNA expression deregulation correlates with the Oncotype DX® DCIS scoreBreast Cancer ResearchSeptember 12, 2022Olivier Loudig, Megan I. Mitchell, Iddo Z. Ben-Dov, Christina Liu, Susan Fineberg50 µM 3’ barcode adapter and incubation with, truncated K227Q T4 RNA Ligase 2 (New England Biolabs, #M0351L) at 4 °C overnight. The next day, samples were heated at 90 °C to inactivate the enzyme and individual

(7) Microtubule integrity regulates budding yeast RAM pathway gene expressionFrontiers in Cell and Developmental BiologySeptember 12, 2022Cameron Howard Lee, Sue BigginsNI814, NI815 for nocodazole replicates) for 3 h at 22°C using T4 Rnl2 (tr) K227Q (New England Biolabs #M0351L). Unligated linkers were then depleted at 30°C for 45 min after addition of 0.5 μl of yeast 5′-deadenylase

(8) Development of a ribosome profiling protocol to study translation in Kluyveromyces marxianusFEMS Yeast ResearchSeptember 12, 2022Darren A Fenton, Stephen J Kiniry, Martina M Yordanova, Pavel V Baranov, John P MorrisseyMassachusetts, USA)) followed by ligation to a DNA linker using T4 RNA ligase 2, truncated K227Q (#M0351L, NEB). The footprints were reverse transcribed using ProtoScript II (#M0368L, NEB). cDNA products were

(9) Mutant FUS and ELAVL4 (HuD) Aberrant Crosstalk in Amyotrophic Lateral SclerosisSSRN Electronic JournalApril 1, 2022Riccardo De Santis et al.paper N/A SU-5402 Sigma-Aldrich SML0443-5MG poly-L-ornithine Sigma-Aldrich Cat#P4957-50ML laminin Sigma-Aldrich Cat#L2020-1MG 4-thiouridine Sigma-Aldrich Cat#T4509 T4 RNA ligase 2, Rnl2(1–249) K227Q ligase New England Biolabs Cat#M0351L Biological Samples Patients’ spinal cord spacimen, see Tables S2 and S3 Chemicals, Peptides, and Recombinant

(10) 40S ribosome profiling reveals distinct roles for Tma20/Tma22 (MCT-1/DENR) and Tma64 (eIF2D) in 40S subunit recyclingNature CommunicationsDecember 1, 2021David J. Young, Sezen Meydan, Nicholas R. Guydosh(UMI) and a 5 nt sample barcode unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). The linkers were pre-adenylated using a 5′ DNA adenylation kit (NEB; E2610L). Unligated linker was

(11) The eIF2 kinase GCN2 directs keratinocyte collective cell migration during wound healing via coordination of reactive oxygen species and amino acidsThe Journal of biological chemistryNovember 1, 2021Miles RR, Amin PH, Diaz MB, Misra J, Aukerman E, Das A, Ghosh N, Guith T, Knierman MD, Roy S, et al.(5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) DNA oligomer was ligated to the tRNA using T4 RNA ligase2 truncated KQ (M0351L, New England BioLabs). An oligomer (5′-GCCTTGGCACCCGAGAATTCCA-3′), complementary to the adaptor sequence,

(12) Modified Cross‐Linking, Ligation, and Sequencing of Hybrids (qCLASH) to Identify MicroRNA TargetsCurrent ProtocolsOctober 5, 2021Lauren A. Gay, Peter C. Turner, Rolf Renne10713023001)1× PNK‐EGTA buffer (see recipe)T4 RNA ligase 2, truncated K227Q, 200,000 U/ml (NEB, cat. no. M0351L)3′ adapter, 10 µM (custom order from IDT, see Table 1)500 mM NaHCO3 SDS (Fisher, cat. no. BP166‐100),

(13) RIPiT-Seq: A tandem immunoprecipitation approach to reveal global binding landscape of multisubunit ribonucleoproteinsMethods in EnzymologyJune 29, 2021Zhongxia Yi, Guramrit Singhsilicone grease (Sigma-Aldrich #Z273554) Quick CIP (NEB #M0525) T4 RNA Ligase 2, truncated K227Q (NEB #M0351L) T4 RNA Ligase Buffer (NEB #B0216L) Biotin-11-dATP (AAT Bioquest #17014 or PerkinElmer #NEL540001EA)

(14) Discordant regulation of eIF2 kinase GCN2 and mTORC1 during nutrient stressNucleic acids researchJune 4, 2021Misra J, Holmes MJ, T Mirek E, Langevin M, Kim HG, Carlson KR, Watford M, Dong XC, Anthony TG, Wek RC.(5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) was ligated to the tRNAs using T4 RNA ligase2 truncated KQ (M0351L, New England BioLabs). The 5′-adenylated adaptor cannot be ligated to the uncharged tRNAs in samples

(15) Extracellular Vesicle Capture by AnTibody of CHoice and Enzymatic Release (EV-CATCHER): A customizable purification assay designed for small-RNA biomarker identification and evaluation of circulating small-EVsJournal of extracellular vesiclesJune 1, 2021Mitchell MI, Ben-Dov IZ, Liu C, Ye K, Chow K, Kramer Y, Gangadharan A, Park S, Fitzgerald S, Ramnauth A, et al.incubated on ice for 2 min, and 1 μl (1/10 diluted) truncated K227Q T4 RNA Ligase 2 (New England Biolabs, #M0351L) was added to each reaction, which were then incubated O/N on ice in a cold room. The next day, ligations

(16) Co-transcriptional splicing regulates 3′ end cleavage during mammalian erythropoiesisMolecular CellMarch 1, 2021Kirsten A. Reimer, Claudia A. Mimoso, Karen Adelman, Karla M. NeugebauerDynabeads mRNA DIRECT Micro Purification Kit,ThermoFisher,61021 Ribo-Zero Gold rRNA Removal Kit,Illumina,MRZG126 T4 RNA ligase Kit,NEB,M0351L SMARTer PCR cDNA Synthesis Kit,Clontech,634925 Advantage 2 PCR Kit,Clontech,639201 AMPure XP Beads,Agencourt,A63880 SuperScriptIII

(17) Preparation of Mammalian Nascent RNA for Long Read SequencingCurrent Protocols in Molecular BiologyDecember 1, 2020Kirsten A. Reimer, Karla M. Neugebauercat. no. SM1331) DNA adapter (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) T4 RNA ligase kit (NEB, cat. no. M0351L) Vortex Thermomixer Refrigerated microcentrifuge 2-ml tube (Dot Scientific, cat. no. RN2000-GMT) RNeasy

(18) Stress-Induced Translation Inhibition through Rapid Displacement of Scanning Initiation FactorsMolecular CellNovember 5, 2020Stefan Bresson, Vadim Shchepachev, Christos Spanos, Tomasz W. Turowski, Juri Rappsilber, David Tollervey(1x PNK buffer, 20 U T4 RNA ligase I (NEB Cat#M0204L), 20 U T4 RNA Ligase II truncated K227Q (NEB Cat#M0351L), 80 U RNasIN, 1 μM preadenylated 3′ miRCat-33 linker (IDT); 25°C for 6 h).3.5′ end phosphorylation

(19) Ribosome profiling in mouse hippocampus: plasticity-induced regulation and bidirectional control by TSC2 and FMRPMolecular autismOctober 14, 2020Hien A, Molinaro G, Liu B, Huber KM, Richter JD.enzyme (NEB, #M0201S) and ligated to preadenylated adaptors (IDT) using T4RNL2Tr.K227Q ligase (NEB, #M0351L). Reverse transcription (RT) was performed using SuperScript III (Invitrogen, #18080-044) in a modified

(20) Disome and Trisome Profiling Reveal Genome-wide Targets of Ribosome Quality ControlMolecular CellAugust 1, 2020Sezen Meydan, Nicholas R. Guydosh(NEB; E2610L), were then ligated to dephosphorylated RNAs using T4 truncated RNA ligase 2 (K227Q) (NEB; M0351L). Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB; M0331S) and RecJ exonuclease

Be the First to Write a Review!